Public Sigenae Contig Browser Seabream SNPView

                
Based on Ensembl release 40 - Aug 2006
 

SNP Report

SNP snp_AM951345_473 (putativeSNP1)
Synonyms None currently in the database
Alleles T/C (ambiguity code: Y)
Validation status Unknown
Linkage disequilibrium
data
No linkage data for this SNP
Sequence region 
GATATGCCTGGTCTTCGCCGATAGCCACTGATCACTCGGCGTCTTCAGCCCTCTGCGTGG
YCTGAAGAAGCACCAGGGGTGACAGCACATGGGCAGATATTGTCATCATGGTGGAAATGT
G     (SNP highlighted)

- Genotype frequencies per population

This SNP has not been genotyped in a population.

- Allele frequencies per population

This SNP has no allele frequences per population.

- SNP snp_AM951345_473 is located in the following transcripts

There are no transcripts that contain this SNP.

- SNP Context - contig AM951345.p.sb.5 487

Click for Menu Click for Menu Click for Menu

+ Individual genotypes for SNP snp_AM951345_473

 

© 2010 INRA / WTSI / EBI.