Public Sigenae Contig Browser Cow SNPView

                
Based on Ensembl release 40 - Aug 2006
 

SNP Report

SNP snp_AM036154_221 (putativeSNP1)
Synonyms None currently in the database
Alleles C/T (ambiguity code: Y)
Validation status Unknown
Linkage disequilibrium
data
No linkage data for this SNP
Sequence region 
TCAGACTTGCAGGACAGGAAAGATTTATTGATGTGACTGTGTTGCTTTTGATGGACAAAT
YTTACTCTTGTGCAAGAGAGAACATTGGTTCAGTGCACATGAAGAGTCCCTTTTTGGCAA
A     (SNP highlighted)

- Genotype frequencies per population

This SNP has not been genotyped in a population.

- Allele frequencies per population

This SNP has no allele frequences per population.

- SNP snp_AM036154_221 is located in the following transcripts

There are no transcripts that contain this SNP.

- SNP Context - contig AW356149.p.bt.9 633

Click for Menu Click for Menu Click for Menu Click for Menu Click for Menu

+ Individual genotypes for SNP snp_AM036154_221

 

© 2010 INRA / WTSI / EBI.